Deprecated: please see new documentation site.


Contents

Introduction

mpiBLAST is a freely available, open-source, parallel implementation of NCBI BLAST bioinformatics program.

Version and availability

mpiBLAST version 1.5.0-pio is available on Eric and QueenBee.

Usage

Step 1

Add the following line to your ~/.soft file and run the "resoft" command:

 +mpiblast-1.5.0

The soft environment will create a file $HOME/.ncbirc if not present, you can modify as required

[NCBI]
Data=/usr/local/packages/mpiblast/1.5.0-pio/intel-11.1-mvapich-1.1/ncbi/data

[BLAST]
BLASTDB=/work/$USER/MPIBLAST
BLASTMAT=/usr/local/packages/mpiblast/1.5.0-pio/intel-11.1-mvapich-1.1/ncbi/data

[mpiBLAST]
Shared=/work/$USER/MPIBLAST
Local=/work/$USER/MPIBLAST


Step 2

Below is a sample script which can be used to run mpiblast jobs through PBS:

#!/bin/sh
#
#PBS -A <your allocation>
#PBS -q checkpt
#PBS -M <your email>
#PBS -l nodes=2:ppn=8
#PBS -l walltime=10:00
#PBS -V
#PBS -N mpiblast
#PBS -m ae

export FORMTEXEC=mpiformatdb
export BLASTEXEC=mpiblast
export EXECDIR=/usr/local/packages/mpiblast/1.5.0-pio/intel-11.1-mvapich-1.1/bin
export WORK_DIR=$PBS_O_WORKDIR
export NPROCS=`wc -l $PBS_NODEFILE |gawk '//{print $1}'`
cd $WORK_DIR
$EXECDIR/$FORMTEXEC -i drosoph.nt --nfrags=4 -pF
mpirun -machinefile $PBS_NODEFILE -np $NPROCS $EXECDIR/$BLASTEXEC -d drosoph.nt -i test.in -p blastn -o results.txt


Then submit it to run:

qsub mpiblast_test.pbs

You can download the database file used in the above script

wget ftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/drosoph.nt.gz
gunzip drosoph.nt.gz

The input file used was

>Test
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA
TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG
CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA
GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC
AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG
AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT

References

mpiBLAST website: http://www.mpiblast.org

User Guide: http://www.mpiblast.org/Docs/Guide


Users may direct questions to sys-help@loni.org.

Powered by MediaWiki